After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LTA/TNFB cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Human TL1A / TNFSF15 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Rabbit NGFR / TNFRSF16 / P75 Protein (ECD, His Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Rhesus OX40 / CD134 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (Fc Tag)Mouse TNFSF12 Protein (Fc Tag)Human TNFRSF17 / BCMA / CD269 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (His Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinHuman DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Canine TNF-alpha / TNFA / TNFSF1A ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human Osteoprotegerin / TNFRSF11B Protein (His Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman XEDAR / EDA2R Protein (His Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinHuman TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinMouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Rat TNF-alpha / TNFA ProteinFerret TNF-alpha / TNFA ProteinHuman TNFSF10 / TRAIL / APO-2L / CD253 ProteinMouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Human OX-40L / TNFSF4 / CD252 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinMouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat EDAR Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rhesus TNFSF10 / TRAIL / APO-2L ProteinRat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat TNFSF15 / TL1A Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Rhesus CD40 / TNFRSF5 Protein (His Tag)Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat TNFSF12 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Rhesus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 ProteinHuman RANKL / OPGL / TNFSF11 / CD254 ProteinRhesus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus / Human TNFSF12 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rhesus CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Canine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human TNFRSF11A Protein (Fc Tag)Mouse CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Mouse Osteoprotegerin / TNFRSF11B Protein (Fc Tag)

Lymphotoxin-alpha, also known as LT-alpha, TNF-beta, Tumor necrosis factor ligand superfamily member 1, LTA TNFSF1 and TNFB, is a secreted protein which belongs to the tumor necrosis factor family. TNF-beta/TNFSF1/Lymphotoxin alpha is a highly inducible, secreted, and exists as homotrimeric molecule. It is a cytokine that in its homotrimeric form binds to TNFRSF1A / TNFR1, TNFRSF1B / TNFBR and TNFRSF14 / HVEM. In its heterotrimeric form with LTB, TNF-beta/TNFSF1/Lymphotoxin alpha binds to TNFRSF3 / LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells. TNF-beta/TNFSF1/Lymphotoxin alpha forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. It mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. TNF-beta/TNFSF1/Lymphotoxin alpha is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in TNF-beta/TNFSF1/Lymphotoxin alpha are a cause of susceptibility psoriatic arthritis which is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy.

  • Messer G, et al. (1991) Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med. 173(1): 209-19.
  • Banner DW, et al. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell. 73(3): 431-45.
  • Picarella DE, et al. (1993) Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol. 150(9): 4136-50.
  • Images
    • Mouse LTA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items