After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FGF12 transcript variant 1 natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FGF12 cDNA Clone Product Information
RefSeq ORF Size:732bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor 12,transcript variant 1 with HA tag.
Gene Synonym:Fhf1, AV114868, Fgf12
Restriction Site:HindIII + XhoI (5.5kb + 0.76kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FGF12 Gene Plasmid Map
Mouse FGF12 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Cynomolgus FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinHuman FGFR2 / CD332 Protein (ECD, His Tag)Mouse bFGF / FGF2 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Human bFGF / FGF2 ProteinHuman aFGF / FGF1 ProteinHuman FGF9 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Human FGF10 / KGF2 ProteinMouse / Rat aFGF / FGF1 ProteinMouse FGFR3 / CD333 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Human FGF21 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Human FGF18 / FGF-18 Protein (His Tag)Rat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human FGF14 / SCA27 Protein (isoform 1B)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGFBP3 Protein (His Tag)Cynomolgus FGFR3 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF19 ProteinHuman FGF17 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Human FGF6 / FGF-6 ProteinMouse FGFR2 / CD332 Protein (His Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Cynomolgus aFGF / FGF1 ProteinCanine FGF12 ProteinCanine aFGF / FGF1 ProteinRhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Canine FGF14 / SCA27 ProteinCanine FGF9 / FGF-9 Protein (Fc Tag)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Catalog: MG50678-M-Y
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions