Quick Order

Mouse SDC1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SDC1cDNA Clone Product Information
Gene_bank_ref_id:NM_011519.2
cDNA Size:936
cDNA Description:ORF Clone of Mus musculus syndecan 1 DNA.
Gene Synonym:Sstn, Synd, CD138, Synd1, syn-1, AA408134, AA409076, Sdc1
Species:Mouse
Vector:pCMV/hygro-HA
Restriction Site:KpnI + XhoI
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HA Vector Information
 
Vector Name pCMV/hygro-HA
Vector Size 5684bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
Schematic of pCMV/hygro-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.

References
  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.
  • Size / Price
    Catalog:MG50641-M-Y
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Mouse SDC1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"