Quick Order

Text Size:AAA

Mouse DLL4 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse DLL4 cDNA Clone Product Information
RefSeq ORF Size:2061bp
cDNA Description:Full length Clone DNA of Mus musculus delta-like 4 (Drosophila) with Flag tag.
Gene Synonym:Delta4, Dll4
Restriction Site:KpnI + XhoI (5.4kb + 2.11kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 1101 C/T, 1419 A/C, 1635 C/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse DLL4 Gene Plasmid Map
Mouse DLL4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch ligands in mammals and interacts predominantly with Notch 1, which has a key role in vascular development. Recent studies yield substantial insights into the role of DLL4 in angiogenesis. DLL4 is induced by vascular endothelial growth factor (VEGF) and acts downstream of VEGF as a 'brake' on VEGF-induced vessel growth, forming an autoregulatory negative feedback loop inactivating VEGF. DLL4 is downstream of VEGF signaling and its activation triggers a negative feedback that restrains the effects of VEGF. Attenuation of DLL4/Notch signaling results in chaotic vascular network with excessive branching and sprouting. DLL4 is widely distributed in tissues other than vessels including many malignancies. Furthermore, the molecule is internalized on binding its receptor and often transported to the nucleus. In pathological conditions, such as cancer, DLL4 is up-regulated strongly in the tumour vasculature. Blockade of DLL4-mediated Notch signaling strikingly increases nonproductive angiogenesis, but significantly inhibits tumor growth in preclinical mouse models. In preclinical studies, blocking of DLL4/Notch signaling is associated with a paradoxical increase in tumor vessel density, yet causes marked growth inhibition due to functionally defective vasculature. Thus, DLL4 blockade holds promise as an additional strategy for angiogenesis-based cancer therapy.

  • Yan M, et al. (2007) Delta-like 4/Notch signaling and its therapeutic implications. Clin Cancer Res. 13(24): 7243-6.
  • Sainson RC, et al. (2007) Anti-Dll4 therapy: can we block tumour growth by increasing angiogenesis? Trends Mol Med. 13(9): 389-95.
  • Martinez JC, et al. (2009) Nuclear and membrane expression of the angiogenesis regulator delta-like ligand 4 (DLL4) in normal and malignant human tissues. Histopathology. 54(5): 598-606.
  • Li JL, et al. (2010) Targeting DLL4 in tumors shows preclinical activity but potentially significant toxicity. Future Oncol. 6(7): 1099-103.