Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ADIPOQ cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Mouse ADIPOQ Gene Plasmid Map
Mouse ADIPOQ Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Adiponectin (ADIPOQ), or 30 kDa adipocyte complement-related protein (Acrp30) is a protein secreted by adipose tissue, which acts to reduce insulin resistance and atherogenic damage, but it also exerts actions in other tissues. Adiponectin mediates its actions in the periphery mainly via two receptors, AdipoR1 and AdipoR2. Adiponectin influences gonadotropin release, normal pregnancy, and assisted reproduction outcomes. Adiponectin, a beneficial adipokine, represents a major link between obesity and reproduction. Higher levels of adiponectin are associated with improved menstrual function and better outcomes in assisted reproductive cycles. Unlike other adipocytokines produced by adipose tissue, adiponectin appears to have anti-inflammatory, anti-diabetic, and anti-atherogenic properties. Several clinical studies demonstrate the inverse relationship between plasma adiponectin levels and several inflammatory markers including C-reactive protein. Adiponectin attenuates inflammatory responses to multiple stimuli by modulating signaling pathways in a variety of cell types. The anti-inflammatory properties of adiponectin may be a major component of its beneficial effects on cardiovascular and metabolic disorders including atherosclerosis and insulin resistance. Additionally, it is important factor in chronic liver diseases and chronic kidney diseases. Some cancer cell types express adiponectin receptors. Thus Adiponectin may act on tumour cells directly by binding and activating adiponectin receptors and downstream signalling pathways.

References
  • Cui J, et al. (2011) The role of adiponectin in metabolic and vascular disease: a review. Clin Nephrol. 75(1): 26-33.
  • Michalakis KG, et al. (2010) The role of adiponectin in reproduction: from polycystic ovary syndrome to assisted reproduction. Fertil Steril. 94(6): 1949-57.
  • Dez JJ, et al.. (2010) The role of the novel adipocyte-derived protein adiponectin in human disease: an update. Mini Rev Med Chem. 10(9): 856-69.
  • Ouchi N, et al. (2007) Adiponectin as an anti-inflammatory factor. Clin Chim Acta. 380(1-2): 24-30.
  • Barb D, et al. (2006) Adiponectin: a link between obesity and cancer. Expert Opin Investig Drugs. 15(8): 917-31.
  • Images
    • Mouse ADIPOQ Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"