Quick Order

Text Size:AAA

Mouse EFNB2 ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse EphrinB2/EFNB2 cDNA Clone Product Information
RefSeq ORF Size:1011bp
cDNA Description:Full length Clone DNA of Mus musculus Ephrin-B2 with His tag.
Gene Synonym:Epl5, ELF-2, Eplg5, Htk-L, Lerk5, LERK-5, NLERK-1, Efnb2
Restriction Site:KpnI + XhoI (5.4kb + 1.06kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-His Vector Information
Vector Name pCMV2-His
Vector Size 5598bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Mouse EphA3 Protein (aa 569-984)Rat EphA3 Protein (Fc Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB2 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA4 Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinHuman EphB1 / EPHT2 Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (His Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Rat EphA3 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Rhesus EphA4 Protein (Fc Tag)Rat EphA4 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Human EphA3 Protein (His Tag)Rhesus EphA4 Protein (His Tag)Human EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Human EphA2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinRhesus EphB1 / EPHT2 Protein (Fc Tag)Mouse EphA3 Protein (aa 569-984, His & GST Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Rat EphA7 / Eph Receptor A7 Protein (Fc Tag)

EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing arterial versus venous identity and perhaps in anastamosing arterial and venous vessels at their junctions. The transmembrane-associated ephrin ligands and their Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Eph receptors and ephrins are divided into two subclasses, A and B, based on binding specificities. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. EphrinB2 expression progressively extends from the arterial endothelium to surrounding smooth muscle cells and to pericytes, suggesting that ephrin-B2 may play an important role during formation of the arterial muscle wall.

  • Wang HU, et al. (1998) Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell. 93(5): 741-53.
  • Gale NW, et al. (2001) Ephrin-B2 selectively marks arterial vessels and neovascularization sites in the adult, with expression in both endothelial and smooth-muscle cells. Dev Biol. 230(2): 151-60.
  • Shin D, et al. (2001) Expression of ephrinB2 identifies a stable genetic difference between arterial and venous vascular smooth muscle as well as endothelial cells, and marks subsets of microvessels at sites of adult neovascularization. Dev Biol. 230(2): 139-50.
  • Size / Price
    Catalog: MG50598-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions