Quick Order

Mouse MMP-9 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MMP-9cDNA Clone Product Information
Gene_bank_ref_id:NM_013599.2
cDNA Size:2193
cDNA Description:ORF Clone of Mus musculus matrix metallopeptidase 9 DNA.
Gene Synonym:Clg4b, MMP-9, B/MMP9, AW743869, pro-MMP-9, Mmp9
Species:Mouse
Vector:pCMV/hygro-His
Restriction Site:KpnI + XbaI
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 834 G>A and 1962 C>T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and a number of transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodelling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils, and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent of the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. In addition, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions clearly points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.

References
  • St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.
  • St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.
  • Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.
  • Size / Price
    Catalog:MG50560-M-H
    List Price: $445.00  (Save $130.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Mouse MMP-9 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"