After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ICAM1cDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.