After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse CD54 / ICAM1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ICAM1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Mouse ICAM1 Gene Plasmid Map
Mouse CD54 / ICAM1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Mouse ICAM1 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Mouse CD54 / ICAM1 natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.