After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse LIFR ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LIFR cDNA Clone Product Information
RefSeq ORF Size:3279bp
cDNA Description:Full length Clone DNA of Mus musculus leukemia inhibitory factor receptor with His tag.
Gene Synonym:LIF, AW061234, A230075M04Rik, Lifr
Restriction Site:KpnI + XhoI (5.5kb + 3.31kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 3273T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse LIFR Gene Plasmid Map
Mouse LIFR Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Human Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin ProteinHuman LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6RA / CD126 Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Human CNTFR / CNTFR-alpha Protein (His Tag)Human IL11RA / IL11Rα Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Human CNTF Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat CNTFR / CNTFR-alpha Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat CNTF / Ciliary Neurotrophic Factor ProteinHuman G-CSFR / CD114 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Rat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinRat IL6 / Interleukin-6 ProteinRat LIFR Protein (His Tag)Rhesus IL6 / Interleukin-6 ProteinHuman IL11 / Interleukin 11 / IL-11 ProteinHuman LIF Protein (His Tag)Human LIF Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinCanine IL11RA / IL-11RA / IL11Rα ProteinRat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Mouse LIF ProteinHuman Interleukin-31 receptor A / IL31RA Protein (His Tag)

LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.

  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • Size / Price
    Catalog: MG50423-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions