After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse MS4A1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD20/MS4A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_007641.5
RefSeq ORF Size:876bp
cDNA Description:Full length Clone DNA of Mus musculus membrane-spanning 4-domains, subfamily A, member 1.
Gene Synonym:Cd20, Ly-44, Ms4a2, AA960661, Ms4a1
Species:Mouse
Vector:pCMV/hygro
Plasmid:pCMV-mMS4A1
Restriction Site:NheI + XhoI (5.5kb + 0.88kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

References
  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • Size / Price
    Catalog: MG50399-G-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"