Quick Order

Mouse ALK-2 / ACVR1 natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ALK-2/ACVR1 cDNA Clone Product Information
RefSeq ORF Size:1530bp
cDNA Description:Full length Clone DNA of Mus musculus activin A receptor, type 1 with HA tag.
Gene Synonym:ALK2, Acvr, Alk8, SKR1, Alk-2, Tsk7L, ActR-I, ActRIA, Acvrlk2, D330013D15Rik, Acvr1
Restriction Site:HindIII + XhoI (5.5kb + 1.56kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 240G/A and 927 A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability to bind activin in concert with ActRII or ActRIIB. ALK-2 is also identified as a BMP type I receptor. It has been demonstrated that ALK-2 forms complex with either the BMP-2/7-bound BMPR-II or ACVR2A /ACVR2B. ALK-1 and ALK-2 presenting in the yeast Saccharomyces cerevisiae are two haspin homologues. Both ALK-1 and ALK-2 exhibit a weak auto-kinase activity in vitro, and are phosphoproteins in vivo. ALK-1 and ALK-2 levels peak in mitosis and late-S/G2. Control of protein stability plays a major role in ALK-2 regulation. The half-life of ALK-2 is particularly short in G1. Overexpression of ALK-2, but not of ALK-1, causes a mitotic arrest, which is correlated to the kinase activity of the protein. This suggests a role for ALK-2 in the control of mitosis. Endoglin is phosphorylated on cytosolic domain threonine residues by the TGF-beta type I receptors ALK-2 and ALK-5 in prostate cancer cells. Endoglin did not inhibit cell migration in the presence of constitutively active ALK-2. Defects in ALK-2 are a cause of fibrodysplasia ossificans progressiva (FOP).

  • Armes NA,et al. (1997) The ALK-2 and ALK-4 activin receptors transduce distinct mesoderm-inducing signals during early Xenopus development but do not co-operate to establish thresholds. Development 124(19): 3797-804.
  • Armes NA, et al. (1999) A short loop on the ALK-2 and ALK-4 activin receptors regulates signaling specificity but cannot account for all their effects on early Xenopus development. J Biol Chem. 274(12):7929-35.
  • Kawai S, et al. (2000) Mouse smad8 phosphorylation downstream of BMP receptors ALK-2, ALK-3, and ALK-6 induces its association with Smad4 and transcriptional activity.Biochem Biophys Res Commun. 271(3):682-7.
  • Deng Y, et al. (2009) Efficient highly selective synthesis of methyl 2-(ethynyl)alk-2(E)-enoates and 2-(1'-chlorovinyl)alk-2(Z)-enoates from 2-(methoxycarbonyl)-2,3-allenols. Organic letters 11(10):2169-72.