After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IL10 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Background

IL-10 is a anti-inflammatory cytokine which belongs to the IL-10 family. It is produced by a variety of cell lines, including T-cells, macrophages, mast cells and other cell types, while it is produced primarily by monocytes and to a lesser extent by lymphocytes. IL-10 is mainly expressed in monocytes and Type 2 T helper cells (TH2), mast cells, CD4+CD25+Foxp3+ regulatory T cells, and also in a certain subset of activated T cells and B cells. IL-10 has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. IL-10 can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. The importance of interleukin 10 for counteracting excessive immunity in the human body is revealed by the fact that patients with Crohn's disease react favorably towards treatment with bacteria producing recombinant IL-10. IL-10 inhibits the synthesis of a number of cytokines, including IFN-gamma, IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper T-cells. It also displays a potent ability to suppress the antigen-presentation capacity of antigen presenting cells. However, it is also stimulatory towards certain T cells and mast cells and stimulates B cell maturation and antibody production.

References
  • Arimoto T, et al. (2007) Interleukin-10 protects against inflammation-mediated degeneration of dopaminergic neurons in substantia nigra. Neurobiol Aging. 28(6):894-906.
  • Han X, et al. (2010) Effect of cobalt protoporphyrin on hyperexpression of heme oxygenase-1 and secretion of IL-10 in rat bone marrow mesenchymal stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 18(5):1297-301.
  • Cui QQ, et al. (2011) Expression of RhoA in the lung tissue of acute lung injury rats and the influence of RhoA on the expression of IL-8 and IL-10. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 77(7): 1436-41.
  • Images
    • Mouse IL10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"