Quick Order

Mouse TGFBR1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TGFBR1 cDNA Clone Product Information
NCBI RefSeq:NM_009370.2
RefSeq ORF Size:1512bp
cDNA Description:Full length Clone DNA of Mus musculus transforming growth factor, beta receptor I with Flag tag.
Gene Synonym:ALK5, Alk-5, TbetaRI, AU017191, TbetaR-I
Restriction Site:NheI + ApaI (5.5kb + 1.54kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse TGFBR1 Gene Plasmid Map
Mouse TGFBR1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Mouse TGFBR1 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Mouse TGFBR1 natural ORF mammalian expression plasmid, Flag tag
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor type I , Serine / threonine-protein kinase receptor R4, Activin receptor-like kinase 5, SKR4, ALK-5, and TGFBR1, is a single-pass type I membrane protein which belongs to the protein kinase superfamily and TGFB receptor subfamily. TGFBR1 / ALK-5 is found in all tissues examined. It is most abundant in placenta and least abundant in brain and heart. TGF-beta functions as a tumor suppressor by inhibiting the cell cycle in the G1 phase. Administration of TGF-beta is able to protect against mammary tumor development in transgenic mouse models in vivo. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers, with the majority of colon and gastric cancers being caused by an inactivating mutation of TGF-beta RII. On ligand binding, TGFBR1 / ALK-5 forms a receptor complex consisting of two type I I and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which auto-phosphorylate, then bind and activate SMAD transcriptional regulators. TGF-beta signaling via TGFBR1 / ALK-5 is not required in myocardial cells during mammalian cardiac development, but plays an irreplaceable cell-autonomous role regulating cellular communication, differentiation and proliferation in endocardial and epicardial cells. Defects in TGFBR1 / ALK-5 are the cause of Loeys-Dietz syndrome type 1A (LDS1A), Loeys-Dietz syndrome type 2A (LDS2A), and aortic aneurysm familial thoracic type 5 (AAT5).

  • Seki T, et al. (2006) Nonoverlapping expression patterns of ALK1 and ALK5 reveal distinct roles of each receptor in vascular development. Lab Invest. 86(2): 116-29. et al.
  • Piek E, et al. (1999) TGF-(beta) type I receptor/ALK-5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells. J Cell Sci. 112 (24): 4557-68. et al.
  • Dudas M, et al. (2004) Tgf-beta3-induced palatal fusion is mediated by Alk-5/Smad pathway. Dev Biol. 266(1): 96-108.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.