Quick Order

Mouse NT5E Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NT5EcDNA Clone Product Information
Gene_bank_ref_id:NM_011851.3
cDNA Size:1731
cDNA Description:ORF Clone of Mus musculus 5' nucleotidase, ecto DNA.
Gene Synonym:NT, Nt5, eNT, CD73, AI447961, 2210401F01Rik, Nt5e
Species:Mouse
Vector:pCMV/hygro
Restriction Site:NheI+ XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 9 C/T and 12 G/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

References
  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • Size / Price
    Catalog:MG50231-M-N
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Mouse NT5E Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"