Quick Order

Mouse TLR3 ORF mammalian expression plasmid, Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TLR3 cDNA Clone Product Information
RefSeq ORF Size:2718bp
cDNA Description:Full length Clone DNA of Mus musculus toll-like receptor 3 with Myc tag.
Gene Synonym:AI957183
Restriction Site:NheI + XhoI (5.5kb + 2.75kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-Myc Vector Information
Vector Name pCMV/hygro-Myc
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Toll-like receptor 3 (TLR3) also known as CD283 (cluster of differentiation 283) is a member of the Toll-like receptor family of pattern recognition receptors of the innate immune system. TLR3/CD283 plays a fundamental role in pathogen recognition and activation of innate immunity. TLR3 is a nucleotide-sensing TLR which is activated by double-stranded RNA, a sign of viral infection. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses.

  • Muzio M, et al.. (2000) Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J Immunol. 164(11): 5998-6004.
  • Doyle S, et al.. (2002) IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity. 17(3): 251-63.
  • Choe J, et al.. (2005) Crystal structure of human toll-like receptor 3 (TLR3) ectodomain. Science. 309(5734): 581-5.
  • Size / Price
    Catalog: MG50161-M-M
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions