After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetReviewsRelated ProductsProtocols
Mouse IL7RA/CD127 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Mouse IL7RA/CD127 Gene Plasmid Map
Mouse IL7R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Rhesus CD122 / IL-2RB Protein (Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Rhesus CD122 / IL-2RB Protein (His Tag)Mouse IL7 / Interleukin 7 ProteinMouse CD123 / IL3RA Protein (ECD, His Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL13 / ALRH Protein (Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Mouse IL2RG Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL13 / ALRH ProteinMouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL4R / CD124 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Human IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Human IL3RA / CD123 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse IL2RG / CD132 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman IL-9 / Interleukin-9 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse IL2RA / CD25 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human Interleukin-21 / IL-21 ProteinHuman IL13 / ALRH ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinHuman IL2RG / CD132 Protein (His Tag)Mouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Rat IL9R / Interleukin 9 receptor Protein (His Tag)Canine IL5 Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinCanine IL4 / Interleukin-4 ProteinMouse IL21 / Interleukin 21 ProteinCanine IL21 / Interleukin 21 ProteinRat IL4R / Il4ra Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL13RA1 Protein (Fc Tag)Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL13RA2 / IL13R Protein (His Tag)Canine IL-8 / CXCL8 ProteinMouse IL13 / ALRH ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Human IL7 / interleukin 7 ProteinRat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Rhesus IL-8 / CXCL8 ProteinMouse IL5Ra / CD125 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL21 / Interleukin 21 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Cynomolgus IL2RA Protein (His Tag)Rat IL7R / IL7RA Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Cynomolgus IL2RA ProteinCanine IL13RA2 / IL13R Protein (Fc Tag)Human IL5 / Interleukin 5 ProteinMouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Rat IL7 / interleukin 7 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-15 / IL15 / Interleukin 15 ProteinHuman IL-8 / CXCL8 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)

Interleukin 7 Receptor alpha (IL-7RA), also known as CD127, is a 75 kDa hematopoietin receptor superfamily member that plays an important role in lymphocyte differentiation, proliferation, and survival. IL-7 receptor alpha (CD127) signaling is essential for T-cell development and regulation of naive and memory T-cell homeostasis. IL-7RA is critically required for the proper development and function of lymphoid cells. Therefore, the IL-7RA is critically required for the proper development and function of lymphoid cells. Studies from both pathogenic and controlled HIV infection indicate that the containment of immune activation and preservation of CD127 expression are critical to the stability of CD4(+) T cells in infection. A better understanding of the factors regulating CD127 expression in HIV disease, particularly on T(CM) cells, might unveil new approaches exploiting the IL-7/IL-7R receptor pathway to restore T cell homeostasis and promote immune reconstitution in HIV infection. Factors relevant to HIV infection that could potentially decrease CD127 expression on human CD8(+) T cells. CD127 down-regulation may be an important contributor to HIV-associated T-cell dysfunction. In addition to IL-7, IL-7RA also associates with TSLPR to form the functional receptor for thymic stromal lymphopoietin (TSLP) which indirectly regulates T cell development by modulating dendritic cell activation. Mutations in the human IL-7RA gene cause a type of severe combined immunodeficiency in which the major deficiencies are in T cell development, whereas B and NK cells are relatively normal in number. Variation in the IL7RA gene was recently found associated with multiple sclerosis (MS). The polymorphisms in the IL7RA gene is involved in MS pathogenesis and suggest that IL7RA variation may primarily affect chronic disease courses. Soluble CD127 (sCD127) appears to play an important role in the immunopathogenesis of several chronic infections, multiple sclerosis, and various cancers.

  • Vranjkovic A, et al. (2007) IL-7 decreases IL-7 receptor alpha (CD127) expression and induces the shedding of CD127 by human CD8+ T cells. Int Immunol. 19(12): 1329-39.
  • Kiazyk SA, et al. (2008) Loss of CD127 expression links immune activation and CD4(+) T cell loss in HIV infection. Trends Microbiol. 16(12): 567-73.
  • Akkad DA, et al. (2009) Variation in the IL7RA and IL2RA genes in German multiple sclerosis patients. J Autoimmun. 32(2): 110-5.
  • Crawley AM, et al. (2010) Soluble IL-7R alpha (sCD127) inhibits IL-7 activity and is increased in HIV infection. J Immunol. 184(9): 4679-87.
  • Images
    • Mouse IL7R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.