After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CD64 / FCGR1 ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD64/FCGR1 cDNA Clone Product Information
RefSeq ORF Size:1215bp
cDNA Description:Full length Clone DNA of Mus musculus Fc receptor, IgG, high affinity I with His tag.
Gene Synonym:CD64, IGGHAFC, AI323638, AV092959, FcgammaRI, Fcgr1
Restriction Site:KpnI + XhoI (5.5kb + 1.25kb)
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Mouse high affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membrane glycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of a signal peptide that allows its transport to the surface of a cell, three extracellular immunoglobulin domains of the C2-type that it uses to bind antibody, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is constitutively found on only macrophages and monocytes, but treatment of polymorphonuclear leukocytes with cytokines like IFNγ and G-CSF can induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.