Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD64/FCGR1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Mouse CD64/FCGR1 Gene Plasmid Map
Mouse CD64 / FCGR1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membrane glycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of a signal peptide that allows its transport to the surface of a cell, three extracellular immunoglobulin domains of the C2-type that it uses to bind antibody, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is constitutively found on only macrophages and monocytes, but treatment of polymorphonuclear leukocytes with cytokines like IFNγ and G-CSF can induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.

  • Mouse CD64 / FCGR1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Recently Viewed Items