After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CBS Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CBScDNA Clone Product Information
cDNA Size:1656
cDNA Description:ORF Clone of Homo sapiens cystathionine-beta-synthase DNA.
Gene Synonym:HIP4, CBS
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
List Price: $395.00  (Save $80.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human CBS Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items