Quick Order

Human IL23R natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL23R cDNA Clone Product Information
RefSeq ORF Size:684bp
cDNA Description:Full length Clone DNA of interleukin 23 receptor with HA tag.
Gene Synonym:IL23R
Restriction Site:KpnI + XhoI (5.4kb + 0.73kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL23R Gene Plasmid Map
Human IL23R Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human IL-12 Protein (IL12A & IL12B Heterodimer) Protein (His Tag)Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL-23 (IL12B & IL23A Heterodimer) Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL23A & Mouse IL12B Heterodimer Protein (His Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12B / P40 Protein (Fc Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12RB1 / IL12RB / CD212 Protein (His Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL-23 (IL23A & IL12B Heterodimer) ProteinRat gp130 / IL6ST / CD130 Protein (His Tag)Mouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL12B / IL-12B Protein (Fc Tag)Rat IL-23 (IL23A & IL12B Heterodimer) ProteinMouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag)Human IL27 / Interleukin-27 Protein (His Tag)Mouse IL27 / Interleukin-27 Protein (His Tag)Mouse IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Rat IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinMouse IL-23 (IL23A & IL12B Heterodimer) ProteinMarmoset IL12B / IL-12B Protein (Fc Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Marmoset IL-23 (IL23A & IL12B Heterodimer) ProteinRhesus IL-12 (IL12A & IL12B Heterodimer) ProteinRhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12A & IL27B Heterodimer ProteinRhesus IL12A / NKSF1 Protein (Fc Tag)

IL23R, also known as IL23 receptor, belongs to the type I cytokine receptor family, Type 2 subfamily. It contains 2 fibronectin type-III domains and is expressed by monocytes, Th1, Th0, NK and dendritic cells. Isoform 1 is specifically expressed in NK cells. IL23R associates with IL12RB1 to form the interleukin-23 receptor. It binds IL23 and mediates T-cells, NK cells and possibly certain macrophage/myeloid cells stimulation probably through activation of the Jak-Stat signaling cascade. IL23 functions in innate and adaptive immunity and may participate in acute response to infection in peripheral tissues. IL23 may be responsible for autoimmune inflammatory diseases and be important for tumorigenesis. Genetic variations in IL23R are associated with inflammatory bowel disease type 17 (IBD17). IBD17 is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. Genetic variations in IL23R also can cause susceptibility to psoriasis type 7.

  • Duerr RH, et al. (2006) A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 314(5804):1461-3.
  • Cargill M, et al. (2007) A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet. 80(2):273-90.
  • Dubinsky MC, et al. (2007) IL-23 receptor (IL-23R) gene protects against pediatric Crohn's disease. Inflamm Bowel Dis. 13(5):511-5.
  • Tremelling M, et al. (2007) IL23R variation determines susceptibility but not disease phenotype in inflammatory bowel disease. Gastroenterology. 132(5):1657-64.