Quick Order

Text Size:AAA

Human LRG1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LRG1cDNA Clone Product Information
cDNA Size:1044
cDNA Description:ORF Clone of Homo sapiens leucine-rich alpha-2-glycoprotein 1 DNA.
Gene Synonym:LRG, HMFT1766, LRG1
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

LRG1 belongs to the leucine-rich repeat (LRR) family. Members of this family are involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is expressed during granulocyte differentiation. It contains 4 LIM zinc-binding domains and 1 Rho-GAP domain.

  • O Donnell LC. et al., 2002, J Leukoc Biol. 72 (3): 478-85.
  • Li X. et al., 2007, Neurosci Lett. 413 (2): 141-4.
  • Ramachandran P. et al., 2006, J Proteome Res. 5 (6): 1493-503.