Quick Order

Human TMPRSS2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TMPRSS2 cDNA Clone Product Information
RefSeq ORF Size:1479bp
cDNA Description:Full length Clone DNA of Homo sapiens transmembrane protease, serine 2.
Gene Synonym:PP9284, PRSS10, FLJ41954, TMPRSS2
Restriction Site:NheI + XhoI (5.5kb + 1.48kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TMPRSS2 Gene Plasmid Map
Human TMPRSS2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name