Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HRAS cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human HRAS Gene Plasmid Map
Human HRAS Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

HRas, also known as HRAS, belongs to the small GTPase superfamily, Ras family and is widely expressed. It functions in signal transduction pathways. HRas can bind GTP and GDP, and they have intrinsic GTPase activity. It undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Defects in HRAS are the cause of faciocutaneoskeletal syndrome (FCSS). FCSS is arare condition characterized by prenatally increased growth, postnatal growth deficiency, mental retardation, distinctive facial appearance, cardiovascular abnormalities, tumor predisposition, skin and musculoskeletal abnormalities. Defects in HRAS also can cause congenital myopathy with excess of muscle spindles. HRAS deficiency may be a cause of susceptibility to Hurthle cell thyroid carcinoma. It has been shown that defects in HRAS can cause susceptibility to bladder cancer which is a malignancy originating in tissues of the urinary bladder. It often presents with multiple tumors appearing at different times and at different sites in the bladder. Most bladder cancers are transitional cell carcinomas. They begin in cells that normally make up the inner lining of the bladder. Other types of bladder cancer include squamous cell carcinoma (cancer that begins in thin, flat cells) and adenocarcinoma (cancer that begins in cells that make and release mucus and other fluids). Bladder cancer is a complex disorder with both genetic and environmental influences. Defects in HRAS are the cause of oral squamous cell carcinoma.

  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Gripp KW, et al. (2011) Molecular confirmation of HRAS p.G12S in siblings with Costello syndrome. Am J Med Genet A. 155A(9):2263-8.
  • Na KY, et al. (2012) Allelic loss of susceptibility loci and the occurrence of BRAF and RAS mutations in patients with familial non-medullary thyroid cancer. J Surg Oncol. 105(1):10-4.
  • Membrino A, et al. (2011) G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy. PLoS One. 6(9):e24421.
  • Images
    • Human HRAS Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items