Quick Order

Text Size:AAA

Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IDH1cDNA Clone Product Information
Gene_bank_ref_id:NM_005896.2
cDNA Size:1245
cDNA Description:ORF Clone of Homo sapiens isocitrate dehydrogenase 1 (NADP+), soluble DNA.
Gene Synonym:IDH, IDP, IDCD, IDPC, PICD, IDH1
Species:Human
Vector:pCMV/hygro-His
Restriction Site:KpnI + XhoI
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged on other vectors
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12055-ACG$325
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12055-ACR$325
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12055-ANG$325
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12055-ANR$325
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12055-CF$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12055-CH$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12055-CM$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12055-CY$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone)HG12055-G$125
Human IDH1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG12055-G-F$325
Human IDH1 Gene cDNA Clone (full-length ORF Clone) expression ready, HA-taggedHG12055-G-Y$325
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12055-NF$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12055-NH$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12055-NM$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12055-NY$295
Human IDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12055-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
References
  • Takano S, et al. (2011) Detection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing. Brain Tumor Pathol. 28(2): 115-23.
  • Geisbrecht BV, et al. (1999) The human PICD gene encodes a cytoplasmic and peroxisomal NADP(+)-dependent isocitrate dehydrogenase. J Biol Chem. 274(43): 30527-30533.
  • Nekrutenko A, et al. (1998) Cytosolic isocitrate dehydrogenase in humans, mice, and voles and phylogenetic analysis of the enzyme family. Mol Biol Evol. 15(12): 1674-1684.
  • Henke B, et al. (1998) IDP3 encodes a peroxisomal NADP-dependent isocitrate dehydrogenase required for the beta-oxidation of unsaturated fatty acids. J Biol Chem. 273(6): 3702-3711.
  • Gabriel JL, et al. (1986) Activity of purified NAD-specific isocitrate dehydrogenase at modulator and substrate concentrations approximating conditions in mitochondria. Metabolism. 35(7): 661-667.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"