Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human WFIKKN2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human WFIKKN2 Gene Plasmid Map
Human WFIKKN2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

WAP, kazal, immunoglobulin, kunitz and NTR domain-containing protein 2, also known as Growth and differentiation factor-associated serum protein 1, WAP, follistatin, immunoglobulin, kunitz and NTR domain-containing-related protein, WFIKKN-related protein, WFIKKN2 and GASP1, is a secreted protein which belongs to the WFIKKN family. WFIKKN2 contains two BPTI/Kunitz inhibitor domains, one Ig-like C2-type (immunoglobulin-like) domain, one Kazal-like domain, one NTR domain and one WAP domain. WFIKKN2 is primarily expressed in ovary, testis and brain, but not in liver. In fetal tissues, it is primarily expressed in brain, skeletal muscle, thymus and kidney. WFIKKN2 is protease-inhibitor that contains multiple distinct protease inhibitor domains. It probably has serine protease- and metalloprotease-inhibitor activity. It inhibits the biological activity of mature myostatin, but not activin. WFIKKN2 protein binds mature GDF8/myostatin and myostatin propeptide and inhibits the biological activity of myostatin.

  • Clark H.F.et al., 2003,Genome Res. 13:2265-70.
  • Hill J.J.et al., 2003, Mol. Endocrinol. 17:1144-54.
  • Kondás,K. et al., 2008, J Biol Chem  283 (35):23677-84.
  • Images
    • Human WFIKKN2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items