Quick Order

Human WFIKKN2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human WFIKKN2 cDNA Clone Product Information
RefSeq ORF Size:1731bp
cDNA Description:Full length Clone DNA of Homo sapiens WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 with Flag tag.
Restriction Site:KpnI + XhoI (5.4kb + 1.78kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 684 C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

WAP, kazal, immunoglobulin, kunitz and NTR domain-containing protein 2, also known as Growth and differentiation factor-associated serum protein 1, WAP, follistatin, immunoglobulin, kunitz and NTR domain-containing-related protein, WFIKKN-related protein, WFIKKN2 and GASP1, is a secreted protein which belongs to the WFIKKN family. WFIKKN2 contains two BPTI/Kunitz inhibitor domains, one Ig-like C2-type (immunoglobulin-like) domain, one Kazal-like domain, one NTR domain and one WAP domain. WFIKKN2 is primarily expressed in ovary, testis and brain, but not in liver. In fetal tissues, it is primarily expressed in brain, skeletal muscle, thymus and kidney. WFIKKN2 is protease-inhibitor that contains multiple distinct protease inhibitor domains. It probably has serine protease- and metalloprotease-inhibitor activity. It inhibits the biological activity of mature myostatin, but not activin. WFIKKN2 protein binds mature GDF8/myostatin and myostatin propeptide and inhibits the biological activity of myostatin.

  • Clark H.F.et al., 2003,Genome Res. 13:2265-70.
  • Hill J.J.et al., 2003, Mol. Endocrinol. 17:1144-54.
  • Kondás,K. et al., 2008, J Biol Chem  283 (35):23677-84.
  • Size / Price
    Catalog: HG11998-G-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions