Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HIF1A cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

HIF-1 alpha, also known as HIF1A, contains 1 basic helix-loop-helix (bHLH) domain, 1 PAC (PAS-associated C-terminal) domain and 2 PAS (PER-ARNT-SIM) domains. It is one of the two subunits of Hypoxia-inducible factor-1 (HIF1). HIF1 is a transcription factor found in mammalian cells cultured under reduced oxygen tension that plays an essential role in cellular and systemic homeostatic responses to hypoxia. HIF1 is a heterodimer composed of an alpha subunit and a beta subunit. The beta subunit has been identified as the aryl hydrocarbon receptor nuclear translocator (ARNT). HIF-1 alpha is expressed in most tissues with highest levels in kidney and heart. It is overexpressed in the majority of common human cancers and their metastases, due to the presence of intratumoral hypoxia and as a result of mutations in genes encoding oncoproteins and tumor suppressors. HIF-1 alpha functions as a master transcriptional regulator of the adaptive response to hypoxia. Under hypoxic conditions, it activates the transcription of over 40 genes, including erythropoietin, glucose transporters, glycolytic enzymes, vascular endothelial growth factor, HILPDA, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF1A plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. HIF-1 alpha binds to core DNA sequence 5'-[AG]CGTG-3' within the hypoxia response element (HRE) of target gene promoters. Activation requires recruitment of transcriptional coactivators such as CREBPB and EP300.

References
  • Zhou Q, et al. (2011) Loss of either hypoxia inducible factor 1 or 2 promotes lung cancer cell colonization. Cell Cycle. 10(13):2233-4.
  • Krishnan J, et al. (2012) Dietary obesity-associated Hif1 alpha activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD+ system. Genes Dev. 26(3):259-70.
  • Novo E, et al. (2012) The biphasic nature of hypoxia-induced directional migration of activated human hepatic stellate cells. J Pathol. 226(4):588-97.
  • Dungwa JV, et al. (2011) Overexpression of carbonic anhydrase and HIF-1 in Wilms tumours. BMC Cancer. 11:390.
  • Images
    • Human HIF1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"