Quick Order

Text Size:AAA

Human HIF1A ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HIF1A cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human HIF1A Gene Plasmid Map
Human HIF1A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

HIF-1 alpha, also known as HIF1A, contains 1 basic helix-loop-helix (bHLH) domain, 1 PAC (PAS-associated C-terminal) domain and 2 PAS (PER-ARNT-SIM) domains. It is one of the two subunits of Hypoxia-inducible factor-1 (HIF1). HIF1 is a transcription factor found in mammalian cells cultured under reduced oxygen tension that plays an essential role in cellular and systemic homeostatic responses to hypoxia. HIF1 is a heterodimer composed of an alpha subunit and a beta subunit. The beta subunit has been identified as the aryl hydrocarbon receptor nuclear translocator (ARNT). HIF-1 alpha is expressed in most tissues with highest levels in kidney and heart. It is overexpressed in the majority of common human cancers and their metastases, due to the presence of intratumoral hypoxia and as a result of mutations in genes encoding oncoproteins and tumor suppressors. HIF-1 alpha functions as a master transcriptional regulator of the adaptive response to hypoxia. Under hypoxic conditions, it activates the transcription of over 40 genes, including erythropoietin, glucose transporters, glycolytic enzymes, vascular endothelial growth factor, HILPDA, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF1A plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. HIF-1 alpha binds to core DNA sequence 5'-[AG]CGTG-3' within the hypoxia response element (HRE) of target gene promoters. Activation requires recruitment of transcriptional coactivators such as CREBPB and EP300.

  • Zhou Q, et al. (2011) Loss of either hypoxia inducible factor 1 or 2 promotes lung cancer cell colonization. Cell Cycle. 10(13):2233-4.
  • Krishnan J, et al. (2012) Dietary obesity-associated Hif1 alpha activation in adipocytes restricts fatty acid oxidation and energy expenditure via suppression of the Sirt2-NAD+ system. Genes Dev. 26(3):259-70.
  • Novo E, et al. (2012) The biphasic nature of hypoxia-induced directional migration of activated human hepatic stellate cells. J Pathol. 226(4):588-97.
  • Dungwa JV, et al. (2011) Overexpression of carbonic anhydrase and HIF-1 in Wilms tumours. BMC Cancer. 11:390.