After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CRTAM Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CRTAMcDNA Clone Product Information
Gene_bank_ref_id:NM_019604.2
cDNA Size:1182
cDNA Description:ORF Clone of Homo sapiens cytotoxic and regulatory T cell molecule DNA.
Gene Synonym:ACE2, ACEH, DKFZP434A014
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Cytotoxic and regulatory T-cell molecule, also known as Class-I MHC-restricted T-cell-associated molecule and CRTAM, is a single-pass type I  membrane protein which belongs to the nectin family. CRTAM contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. In the immune system, the expression of CRTAM is restricted to activated class-I MHC-restricted cells, including NKT and CD8 cells. It is strongly expressed in spleen, thymus, small intestine, peripheral blood leukocyte, and in purkinje neurons in cerebellum. It is expressed at much lower levels in testis, ovary, colon, lung and lymphoid tissues. CRTAM is a member of the immunoglobulin superfamily that complies with the structural characteristics of the JAM family of proteins and is phylogenetically more closely related to nectin-like proteins. It is a molecule involved in epithelial cell adhesion. CRTAM is sensitive to intermediate filament disruption and treatment of monolayers with soluble CRTAM enhances cell-cell dissociation and lowers transepithelial electrical resistance. CRTAM may also induce retention by binding to CD8+ dendritic cells (DCs) at the late stage of activation before proliferation. 

References
  • Garay, E. et al., 2010, J Cell Biochem. 111 (1):111-22.
  • Medina-C.O. et al., 2010, Dev Comp Immunol. 34 (2):196-202.
  • Takeuchi, A. et al., 2009, J Immunol.183 (7):4220-8.
  • Valle-Rios,R. et al., 2009, Mol Immunol. 46 (16): 3379-87.
  • Size / Price
    Catalog:HG11975-G-N
    List Price: $325.00  (Save $30.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human CRTAM Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"