Quick Order

Human CRTAM Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CRTAMcDNA Clone Product Information
cDNA Size:1182
cDNA Description:ORF Clone of Homo sapiens cytotoxic and regulatory T cell molecule DNA.
Gene Synonym:ACE2, ACEH, DKFZP434A014
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Cytotoxic and regulatory T-cell molecule, also known as Class-I MHC-restricted T-cell-associated molecule and CRTAM, is a single-pass type I  membrane protein which belongs to the nectin family. CRTAM contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. In the immune system, the expression of CRTAM is restricted to activated class-I MHC-restricted cells, including NKT and CD8 cells. It is strongly expressed in spleen, thymus, small intestine, peripheral blood leukocyte, and in purkinje neurons in cerebellum. It is expressed at much lower levels in testis, ovary, colon, lung and lymphoid tissues. CRTAM is a member of the immunoglobulin superfamily that complies with the structural characteristics of the JAM family of proteins and is phylogenetically more closely related to nectin-like proteins. It is a molecule involved in epithelial cell adhesion. CRTAM is sensitive to intermediate filament disruption and treatment of monolayers with soluble CRTAM enhances cell-cell dissociation and lowers transepithelial electrical resistance. CRTAM may also induce retention by binding to CD8+ dendritic cells (DCs) at the late stage of activation before proliferation. 

  • Garay, E. et al., 2010, J Cell Biochem. 111 (1):111-22.
  • Medina-C.O. et al., 2010, Dev Comp Immunol. 34 (2):196-202.
  • Takeuchi, A. et al., 2009, J Immunol.183 (7):4220-8.
  • Valle-Rios,R. et al., 2009, Mol Immunol. 46 (16): 3379-87.