After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CEACAM8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CEACAM8cDNA Clone Product Information
cDNA Size:1050
cDNA Description:ORF Clone of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 8 DNA.
Gene Synonym:CD66b
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

CEACAM8, also known as CD66b or NCA-95, is a single chain, GPI-anchored, highly glycosylated protein belonging to the carcinoembryonic antigen family. There are four members in this family: CD66a, CD66b, CD66c, and CD66d. Members of CEACAM family are widely expressed especially on human neutrophils, and, depending on the tissue, capable of regulating diverse functions including tumor promotion, tumor suppression, angiogenesis, and neutrophil activation. Abnormal overexpression and downregulation of some CEACAMs have been described in tumor cells. Monoclonal antibodies grouped in the CD66 cluster recognize CEACAM members. Ectopic CD66 expression is commonly detected in B-cell lineage acute lymphoblastic leukemia (ALL). CEACAM8(CD66b) is also an activation marker for human granulocytes. However, its biological functions are largely unknown in eosinophils. It has been reported that CD66b is highly expressed on the surface of human peripheral blood eosinophils isolated from healthy individuals. Engagement of CD66b by mAb or a natural ligand, galectin-3, activated a Src kinase family molecule, hemopoietic cell kinase (Hck), and induced cellular adhesion, superoxide production, and degranulation of eosinophils. CD66b molecules were localized in lipid rafts, and disruption of lipid rafts or removal of the GPI anchor inhibited the adhesion and activation of eosinophils. Importantly, CD66b was constitutively and physically associated with a beta2 integrin, CD11b, and cross-linking of CD66b induced a striking clustering of CD11b molecules. Thus, CD66b molecules are involved in regulating adhesion and activation of eosinophils, possibly through their localization in lipid rafts and interaction with other cell surface molecules, such as CD11b. Binding of exogenous or endogenous carbohydrate ligands(s) to CD66b may be important in the release of proinflammatory mediators by human eosinophils.

  • Yoon J, et al. (2007) CD66b regulates adhesion and activation of human eosinophils. J Immunol. 179 (12): 8454-62.
  • Skubitz KM, et al. (1996) CD6a, CD66b, CD66c, and CD66d each independently stimulate neutrophils. J Leukoc Biol. 60 (1): 106-17.
  • Skubitz KM, et al. (2008) Inte rdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells. J Transl Med. 6: 78.
  • Lasa A, et al. (2008) High expression of CEACAM6 and CEACAM8 mRNA in acute lymphoblastic leukemias. Ann Hematol. 87 (3): 205-11.