Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SOD1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

SOD1 belongs to the Cu-Zn superoxide dismutase family. It binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. SOD1 destroys radicals which are normally produced within the cells and which are toxic to biological systems. Defects in SOD1 are the cause of amyotrophic lateral sclerosis type 1 (ALS1). ALS1 is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of cases leading to familial forms.

  • Murakami K, et al. (2011) SOD1 (copper/zinc superoxide dismutase) deficiency drives amyloid β protein oligomerization and memory loss in mouse model of Alzheimer disease. J Biol Chem. 286(52):44557-68.
  • Thompson M, et al. (2012) Paradoxical roles of serine racemase and D-serine in the G93A mSOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem. 120(4):598-610.
  • Magrané J, et al. (2012) Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons. J Neurosci. 32(1):229-42.
  • Gertz B, et al. (2012) Nuclear localization of human SOD1 and mutant SOD1-specific disruption of survival motor neuron protein complex in transgenic amyotrophic lateral sclerosis mice. J Neuropathol Exp Neurol. 71(2):162-77.
  • Images
    • Human SOD1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items