Quick Order

Human IL12RB1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL12RB1 cDNA Clone Product Information
RefSeq ORF Size:1989bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 12 receptor, beta 1 with Flag tag.
Gene Synonym:CD212, IL12RB, MGC34454, IL-12R-BETA1, IL12RB1
Restriction Site:HindIII + XbaI (5.4kb + 2.04kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human IL-12 Protein (IL12A & IL12B Heterodimer) Protein (His Tag)Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL-23 (IL12B & IL23A Heterodimer) Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL23A & Mouse IL12B Heterodimer Protein (His Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12B / P40 Protein (Fc Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12RB1 / IL12RB / CD212 Protein (His Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL-23 (IL23A & IL12B Heterodimer) ProteinRat gp130 / IL6ST / CD130 Protein (His Tag)Mouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL12B / IL-12B Protein (Fc Tag)Rat IL-23 (IL23A & IL12B Heterodimer) ProteinMouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag)Human IL27 / Interleukin-27 Protein (His Tag)Mouse IL27 / Interleukin-27 Protein (His Tag)Mouse IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Rat IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinMouse IL-23 (IL23A & IL12B Heterodimer) ProteinMarmoset IL12B / IL-12B Protein (Fc Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Marmoset IL-23 (IL23A & IL12B Heterodimer) ProteinRhesus IL-12 (IL12A & IL12B Heterodimer) ProteinRhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12A & IL27B Heterodimer ProteinRhesus IL12A / NKSF1 Protein (Fc Tag)

Interleukin 12 receptor, beta 1 is also known as IL-12 receptor beta component, IL-12R subunit beta-1, and CD212 antigen (CD212). IL12RB1(CD212) is a subunit of the interleukin 12 receptor. IL12RB1(CD212) is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. IL12RB1(CD212) forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of IL12RB1 and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The lack of expression of this gene was found to result in the immunodeficiency of patients with severe mycobacterial and Salmonella infections. IL12RB1(CD212) Functions as an interleukin receptor which binds interleukin-12 with low affinity and is involved in IL12 transduction. It associated with IL12RB2 it forms a functional, high affinity receptor for IL12. IL12RB1(CD212) associates also with IL23R to form the interleukin-23 receptor which functions in IL23 signal transduction probably through activation of the Jak-Stat signaling cascade.

  • Cleary AM, et al. (2003) Impaired accumulation and function of memory CD4 T cells in human IL-12 receptor beta 1 deficiency. J Immunol. 170 (1): 597-603.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2): 149-56.
  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. Cell Genet. 77 (3-4): 257-8.