After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HSPA1A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HSPA1A cDNA Clone Product Information
RefSeq ORF Size:1926bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock 70kDa protein 1A.
Gene Synonym:HSP72, HSPA1, HSP70I, HSPA1B, HSP70-1, FLJ54303, FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1A, HSPA1A
Restriction Site:HindIII + XbaI (5.5kb + 1.93kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 222 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPA1A Gene Plasmid Map
Human HSPA1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

HSPA1A is a member of the Hsp70 protein family. The 70 kilodalton heat shock proteins (Hsp70s) are a family of ubiquitously expressed heat shock proteins. HSP are abundant and conserved proteins present in all cells. Upon temperature shock or other stress stimuli, HSP are synthesized intracellularly, which may protect cells from protein denaturation or from death. Extracellularly, HSP can serve a cytokine function to initiate both innate and adaptive immunity through activation of APC. HSP serves also a chaperone function and facilitates presentation of antigen peptide to T cells. Molecular chaperones of the Hsp70 family have diverse functions in cells. They assist the folding of newly synthesized and stress-denatured proteins, as well as the import of proteins into organelles, and the dissociation of aggregated proteins. The well-conserved Hsp70 chaperones are ATP dependent: binding and hydrolysis of ATP regulates their interactions with unfolded polypeptide substrates, and ATPase cycling is necessary for their function. All cellular functions of Hsp70 chaperones use the same mechanism of ATP-driven polypeptide binding and release. 

  • Heck TG, et al. (2011) HSP70 expression: does it a novel fatigue signalling factor from immune system to the brain Cell Biochem Funct. 29 (3): 215-26.
  • Chen T, et al. (2010) Stress for maintaining memory: HSP70 as a mobile messenger for innate and adaptive immunity. Eur J Immunol. 40 (6): 1541-4.
  • Young JC. (2010) Mechanisms of the Hsp70 chaperone system. Biochem Cell Biol. 88 (2): 291-300.
  • Size / Price
    Catalog: HG11660-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions