After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human JAG1/JAGL1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human JAG1/JAGL1 Gene Plasmid Map
Human JAG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Protein Jagged 1, also known as JAG1, JAGL1 and CD339, is a single-pass type I  membrane protein which contains 1 DSL domain and 15 EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis. 

JAG1/Jagged 1 seems to be involved in early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly which consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left) and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.

References
  1. Oda T.et al., 1997, Nat. Genet. 16:235-242.
  2. Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  3. Li L. et al., 1998, Immunity. 8:43-55.
  4. Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  5. Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  6. Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  7. Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
Images
  • Human JAG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"