After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AGER cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human AGER Gene Plasmid Map
Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Receptor for Advanced Glycosylation End Products (RAGE, or AGER) is a member of the immunoglobulin super-family transmembrane proteins, as a signal transduction receptor which binds advanced glycation endproducts, certain members of the S100/calgranulin family of proteins, high mobility group box 1 (HMGB1), advanced oxidation protein products, and amyloid (beta-sheet fibrils). Initial studies investigating the role of RAGE in renal dysfunction focused on diabetes, neurodegenerative disorders, and inflammatory responses. However, RAGE also has roles in the pathogenesis of renal disorders that are not associated with diabetes, such as obesity-related glomerulopathy, doxorubicin-induced nephropathy, hypertensive nephropathy, lupus nephritis, renal amyloidosis, and ischemic renal injuries. RAGE represents an important factor in innate immunity against pathogens, but it also interacts with endogenous ligands, resulting in chronic inflammation. RAGE signaling has been implicated in multiple human illnesses, including atherosclerosis, arthritis, Alzheimer's disease, atherosclerosis and aging associated diseases.

  • Zhou Z, et al. (2011) RAGE and its ligands in bone metabolism. Front Biosci (Schol Ed). 3: 768-76.
  • Mosquera JA. (2010) Role of the receptor for advanced glycation end products (RAGE) in inflammation]. Invest Clin. 51(2): 257-68.
  • D'Agati V, et al. (2010) RAGE and the pathogenesis of chronic kidney disease. Nat Rev Nephrol. 6(6): 352-60.
  • Images
    • Human AGER transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items