Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LTC4S cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Leukotriene C4 synthase, also known as LTC4 synthase, Leukotriene-C(4) synthase, and LTC4S, is a multi-pass membrane protein which belongs to the MAPEG family. LTC4S is detected in lung, platelets and the myelogenous leukemia cell line KG-1 (at protein level). LTC4S activity is present in eosinophils, basophils, mast cells, certain phagocytic mononuclear cells, endothelial cells, vascular smooth muscle cells and platelets. LTC4S is essential for the production of cysteinyl leukotrienes (Cys-LT), critical mediators in asthma. Mutagenic analysis of the conjugation function of human LTC4S has identified R51 and Y93 as critical for acid and base catalysis of LTA4 and reduced glutathione, respectively. A comparison across species for proteins that possess LTC4S activity reveals conservation of both of these residues, whereas R51 is absent in the FLAP molecules. Thus, within the glutathione S-transferase superfamily of genes, alignment of specific residues allows the separation of LTC4S family members from their most structurally similar counterparts, the FLAP molecules. Defects in LTC4S are the cause of leukotriene C4 synthase deficiency (LTC4 synthase deficiency). LTC4 synthase deficiency is a fatal neurometabolic developmental disorder. It is associated with muscular hypotonia, psychomotor retardation, failure to thrive, and microcephaly.

References
  • Gupta, N. et al., 1999, FEBS Lett. 449 (1): 66-70.
  • Penrose, JF. et al., 1999, Allergy Asthma Proc. 20 (6): 353-60.
  • Sayers, I. et al., 2003, Thorax. 58 (5): 417-24.
  • Schröder, O. et al., 2005, Cell Mol Life Sci. 62 (1): 87-94.
  • Images
    • Human LTC4S Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"