After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ALDH7A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ALDH7A1cDNA Clone Product Information
cDNA Size:1536
cDNA Description:ORF Clone of Homo sapiens aldehyde dehydrogenase 7 family, member A1 DNA.
Gene Synonym:EPD, PDE, ATQ1, FLJ11738, FLJ92814, ALDH7A1
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human ALDH7A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. Mammalian ALDH7A1 is homologous to plant ALDH7B1 which protects against various forms of stress such as increased salinity, dehydration and treatment with oxidants or pesticides. In mammals, ALDH7A1 is known to play a primary role during lysine catabolism through the NAD+-dependent oxidative conversion of aminoadipate semialdehyde (AASA) to its corresponding carboxylic acid, α-aminoadipic acid. Deleterious mutations in human ALDH7A1 are responsible for pyridoxine-dependent and folinic acid-responsive seizures. ALDH7A1 is a novel aldehyde dehydrogenase expressed in multiple subcellular compartments that protects against hyperosmotic stress by generating osmolytes and metabolizing toxic aldehydes.

  • Brocker C, et al. (2011) Aldehyde dehydrogenase 7A1 (ALDH7A1) attenuates reactive aldehyde and oxidative stress induced cytotoxicity. Chem Biol Interact. 191(1-3): 269-77.
  • Brocker C, et al. (2010) Aldehyde dehydrogenase 7A1 (ALDH7A1) is a novel enzyme involved in cellular defense against hyperosmotic stress. J Biol Chem. 285(24): 18452-63.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human ALDH7A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items