Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ARG1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Arginase is the focal enzyme of the urea cycle hydrolysing L-arginine to urea and L-ornithine. Emerging studies have identified arginase in the vasculature and have implicated this enzyme in the regulation of nitric oxide (NO) synthesis and the development of vascular disease. Arginase also redirects the metabolism of L-arginine to L-ornithine and the formation of polyamines and L-proline, which are essential for smooth muscle cell growth and collagen synthesis. Arginase is encoded by two recently discovered genes (Arginase I and Arginase II). In most mammals, Arginase 1 (ARG1) also known as Arginase, liver, which functions in the urea cycle, and is located primarily in the cytoplasm of the liver. The second isozyme, Arginase II, has been implicated in the regulation of the arginine/ornithine concentrations in the cell. It is located in mitochondria of several tissues in the body, with most abundance in the kidney and prostate. It may be found at lower levels in macrophages, lactating mammary glands, and brain.

  • Durante W, et al. (2007) Arginase: a critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol. 34(9): 906-11.
  • Waddington SN. (2002) Arginase in glomerulonephritis. Kidney Int. 61(3): 876-81.
  • Morris SM. (2002). Regulation of enzymes of the urea cycle and arginine metabolism. Annual review of nutrition. 22 (1): 87-105.
  • Images
    • Human ARG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items