After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN12cDNA Clone Product Information
cDNA Size:2343
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, non-receptor type 12 DNA.
Gene Synonym:PTPG1, PTP-PEST, PTPN12
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

PTPN12 is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTPN12 contains a C-terminal PEST motif, which serves as a protein–protein interaction domain, and may be related to protein intracellular half-life. PTPN12 was found to bind and dephosphorylate the product of oncogene c-ABL, thus may play a role in oncogenesis. PTPN12 was shown to interact with, and dephosphorylate, various of cytoskeleton and cell adhesion molecules, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin, which suggested its regulatory roles in controlling cell shape and mobilit.

  • Garton AJ. et al., 1997, Oncogene. 15 (8): 877-85.
  • Lin Yi. et al., 2003, Am J Physiol Heart Circ. 285 (2): H710-21.
  • Takekawa M. et al., 1994, FEBS Lett. 339 (3): 222-8.
  • Size / Price
    List Price: $445.00  (Save $130.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items