Quick Order

Human PTPN12 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTPN12 cDNA Clone Product Information
Gene_bank_ref_id:NM_002835.3
RefSeq ORF Size:2343bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 12 with Flag tag.
Gene Synonym:PTPG1, PTP-PEST, PTPN12
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-PTPN12-flag
Restriction Site:KpnI + XhoI (5.4kb + 2.39kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PTPN12 Gene Plasmid Map
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PTPN12 is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTPN12 contains a C-terminal PEST motif, which serves as a protein–protein interaction domain, and may be related to protein intracellular half-life. PTPN12 was found to bind and dephosphorylate the product of oncogene c-ABL, thus may play a role in oncogenesis. PTPN12 was shown to interact with, and dephosphorylate, various of cytoskeleton and cell adhesion molecules, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin, which suggested its regulatory roles in controlling cell shape and mobilit.

References
  • Garton AJ. et al., 1997, Oncogene. 15 (8): 877-85.
  • Lin Yi. et al., 2003, Am J Physiol Heart Circ. 285 (2): H710-21.
  • Takekawa M. et al., 1994, FEBS Lett. 339 (3): 222-8.
  • Size / Price
    Catalog: HG11556-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"