After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TLK2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TLK2cDNA Clone Product Information
Gene_bank_ref_id:NM_001284363.1
cDNA Size:2157
cDNA Description:ORF Clone of Homo sapiens tousled-like kinase 2 DNA.
Gene Synonym:MGC44450, PKU-ALPHA, TLK2
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Serine / threonine-protein kinase tousled-like 2, also known as PKU-alpha, Tousled-like kinase 2 and TLK2, is a nucleus protein which belongs to the protein kinase superfamily and Ser/Thr protein kinase family. The tousled-like kinases are an evolutionarily conserved family of proteins implicated in DNA repair, DNA replication and mitosis in metazoans and plants. Their absence from the yeasts and other eukaryotic 'microbes' suggests a specific role for them in the development of multicellular organisms. Tousled-like kinase 2 / TLK2 is widely expressed. It is present in fetal placenta, liver, kidney, pancreas, heart and skeletal muscle. It is also found in adult cell lines. Tousled-like kinase 2 / TLK2 contains one protein kinase domain. Tousled-like kinase 2 / TLK2 is rapidly and transiently inhibited by phosphorylation following the generation of DNA double-stranded breaks during S-phase. This is cell cycle checkpoint and ATM-pathway dependent and appears to regulate processes involved in chromatin assembly.

References
  • Sillje HHW. et al., 2001,Curr Biol. 11: 1068-73.
  • Groth A. et al., 2003, EMBO J. 22: 1676-87.
  • Beausoleil SA. et al., 2004, Proc Natl Acad Sci. 101: 12130-5.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46.
  • Oppermann FS. et al., 2009, Mol Cell Proteomics. 8: 1751-64.
  • Size / Price
    Catalog:HG11551-M-N
    List Price: $545.00  (Save $230.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Human TLK2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"