Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NCR2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human NCR2 Gene Plasmid Map
Human NCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Natural cytotoxicity triggering receptor 2 (NCR2), also known as Natural killer cell p44-related protein (NKp44), or CD336, is a member of the natural cytotoxicity receptor (NCR) family, which composed of one Ig-like extracellular domain, a transmembrane segment, and a cytoplasmic domain. It is a novel transmembrane glycoprotein belonging to the Immunoglobulin superfamily characterized by a single extracellular V-type domain. The cytoplasmic domain of NKp44 also contains a sequence that matches the immunoreceptor tyrosine-based inhibitory motif (ITIM) consensus. This Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis. NKp44 is selectively expressed by IL-2-activated NK cells and may contribute to the increased efficiency of activated NK cells to mediate tumor cell lysis. Tumor cell recognition of the mutated NKp44 proteins was significantly reduced and correlated with their lower recognition of heparin.

References
  • Vitale M, et al. (1998) NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis. J Exp Med. 187(12): 2065-72.
  • Cantoni C, et al. (1999) NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J Exp Med. 189: 787-96.
  • Cantoni C, et al. (2003) The three-dimensional structure of the human NK cell receptor NKp44, a triggering partner in natural cytotoxicity. Structure. 11(6): 725-34.
  • Campbell KS, et al. (2004) NKp44 triggers NK cell activation through DAP12 association that is not influenced by a putative cytoplasmic inhibitory sequence. J Immunol. 172(2): 899-906.
  • Hershkovitz O, et al. (2007) Characterization of the recognition of tumor cells by the natural cytotoxicity receptor, NKp44. Biochemistry. 46(25): 7426-36.
  • Images
    • Human NCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"