Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VSIG2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human VSIG2 Gene Plasmid Map
Human VSIG2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

V-set and immunoglobulin domain-containing protein 2, also known as cortical thymocyte-like protein, CT-like protein and VSIG2, is a single-pass type I membrane protein which contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. VSIG2 is highly expressed in stomach, colon, prostate, trachea and thyroid glands and weakly in bladder and lung. V-set domains are Ig-like domains resembling the antibody variable domain. V-set domains are found in diverse protein families, including immunoglobulin light and heavy chains; in several T-cell receptors such as CD2 (Cluster of Differentiation 2), CD4, CD80, and CD86; in myelin membrane adhesion molecules; in junction adhesion molecules (JAM); in tyrosine-protein kinase receptors; and in the programmed cell death protein 1 (PD1).

References
  • Satow Y, et al.,1986, J. Mol. Biol. 190(4): 593-604. 
  • Kariuki,S.N. et al., 2010, Arthritis Res Ther. 12 (4):R151.
  • Images
    • Human VSIG2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"