After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VSIG2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human VSIG2 Gene Plasmid Map
Human VSIG2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

V-set and immunoglobulin domain-containing protein 2, also known as cortical thymocyte-like protein, CT-like protein and VSIG2, is a single-pass type I membrane protein which contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. VSIG2 is highly expressed in stomach, colon, prostate, trachea and thyroid glands and weakly in bladder and lung. V-set domains are Ig-like domains resembling the antibody variable domain. V-set domains are found in diverse protein families, including immunoglobulin light and heavy chains; in several T-cell receptors such as CD2 (Cluster of Differentiation 2), CD4, CD80, and CD86; in myelin membrane adhesion molecules; in junction adhesion molecules (JAM); in tyrosine-protein kinase receptors; and in the programmed cell death protein 1 (PD1).

References
  • Satow Y, et al.,1986, J. Mol. Biol. 190(4): 593-604. 
  • Kariuki,S.N. et al., 2010, Arthritis Res Ther. 12 (4):R151.
  • Images
    • Human VSIG2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"