After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NEK7 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

NIMA (never in mitosis gene a)-related kinase 7, NEK7 belongs to the NIMA subfamily, NEK Ser/Thr protein kinase family, protein kinase superfamily. NEKs (NIMA-related kinases) are mammalian serine/threonine (Ser/Thr) protein kinases structurally related to Aspergillus NIMA (Never in Mitosis, gene A), which plays essential roles in mitotic signaling. NEKs share an amino-terminal catalytic domain related to NIMA, an Aspergillus kinase involved in the control of several aspects of mitosis, and divergent carboxyl-terminal tails of varying length. NEKs are commonly referred to as mitotic kinases, although a definitive in vivo verification of this definition is largely missing. Reduction in the activity of NEK7 or its close paralog, NEK6, has previously been shown to arrest cells in mitosis, mainly at metaphase. NEK7 is a regulator of cell division, and reveal it as an essential component for mammalian growth and survival. The intimate connection between tetraploidy, aneuploidy and cancer development suggests that NEK7 deregulation can induce oncogenesis. The endogenous NEK7 protein is enriched at the centrosome in a microtubule-independent manner. Overexpression of wt or kinase-defective NEK7 resulted in cells of rounder appearance, and higher proportions of multinuclear and apoptotic cells.

  • Belham C, et al. (2003) A mitotic cascade of NIMA family kinases. Nercc1/Nek9 activates the Nek6 and Nek7 kinases. J Biol Chem. 278(37): 34897-909.
  • Minoguchi S, et al.. (2003) Differential control of the NIMA-related kinases, Nek6 and Nek7, by serum stimulation. Biochem Biophys Res Commun. 301(4): 899-906.
  • Yissachar N, et al. (2006) Nek7 kinase is enriched at the centrosome, and is required for proper spindle assembly and mitotic progression. FEBS Lett. 580(27): 6489-95.
  • Salem H, et al. (2010) Nek7 kinase targeting leads to early mortality, cytokinesis disturbance and polyploidy. Oncogene. 29(28): 4046-57.
  • Images
    • Human NEK7 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items