After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDE4BcDNA Clone Product Information
cDNA Size:1695
cDNA Description:ORF Clone of Homo sapiens phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila), transcript variant b DNA.
Gene Synonym:DPDE4, PDE4B5, PDEIVB, MGC126529, DKFZp686F2182, PDE4B
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 789G/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11527-ACG$345
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11527-ACR$345
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11527-ANG$345
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11527-ANR$345
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11527-CF$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11527-CH$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11527-CM$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11527-CY$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone)HG11527-M$115
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11527-NF$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11527-NH$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11527-NM$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11527-NY$315
Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11527-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

  • Bolger al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card al., 2004, Structure 12:2233-47.
  • Card al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human PDE4B transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items