Quick Order

Human FVII / F7 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FVII/F7 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Coagulation factor VII, also known as Serum prothrombin conversion accelerator, Factor VII, F7 and FVII, is a member of the peptidase S1 family. Factor VII is one of the central proteins in the coagulation cascade. It is an enzyme of the serine protease class, and Factor VII (FVII) deficiency is the most frequent among rare congenital bleeding disorders. Factor VII contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one peptidase S1 domain. The main role of factor VII is to initiate the process of coagulation in conjunction with tissue factor (TF). Tissue factor is found on the outside of blood vessels, normally not exposed to the blood stream. The action of the Factor VII is impeded by tissue factor pathway inhibitor (TFPI), which is released almost immediately after initiation of coagulation. Factor VII is vitamin K dependent and is produced in the liver. Upon vessel injury, tissue factor is exposed to the blood and circulating Factor VII. Once bound to TF, FVII is activated to FVIIa by different proteases, among which are thrombin (factor IIa), factor Xa, IXa, XIIa, and the FVIIa-TF complex itself. Recombinant activated factor VII (rFVIIa) is a haemostatic agent, which was originally developed for the treatment of haemophilia patients with inhibitors against factor FVIII or FIX. FVIIa binds specifically to endothelial protein C receptor (EPCR), a known cellular receptor for protein C and activated protein C, on the endothelium. rFVIIa is a novel hemostatic agent, originally developed for the treatment of hemorrhage in hemophiliacs with inhibitors, which has been successfully used recently in an increasing number of nonhemophilic bleeding conditions.

  • Franchini M, et al. (2007) Potential role of recombinant activated factor VII for the treatment of severe bleeding associated with disseminated intravascular coagulation: a systematic review. Blood Coagul Fibrinolysis. 18(7): 589-93.
  • Lapecorella M, et al. (2008) Factor VII deficiency: defining the clinical picture and optimizing therapeutic options. Haemophilia. 14(6): 1170-5.
  • Grottke O, et al. (2010) Activated recombinant factor VII (rFVIIa). Best Pract Res Clin Anaesthesiol. 24(1): 95-106.