After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SUV39H1cDNA Clone Product Information
cDNA Size:1239
cDNA Description:ORF Clone of Homo sapiens suppressor of variegation 3-9 homolog 1 (Drosophila) DNA.
Gene Synonym:MG44, KMT1A, SUV39H, SUV39H1
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1110 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11498-ACG$325
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11498-ACR$325
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11498-ANG$325
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11498-ANR$325
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11498-CF$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11498-CH$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11498-CM$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11498-CY$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone)HG11498-M$195
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11498-M-F$395
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11498-NF$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11498-NH$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11498-NM$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11498-NY$295
Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11498-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $395.00  (Save $100.00)
Price:$295.00      [How to order]
Availability5 business days
  • Human SUV39H1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items