After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetReviewsRelated ProductsProtocols
Human CUTC cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human CUTC Gene Plasmid Map
Human CUTC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Copper homeostasis protein cutC homolog, also known as CGI-32 and CUTC, is a cytoplasm and nucleus protein which belongs to the CutC family. CUTC may play a role in copper homeostasis. It can bind one Cu1+ per subunit. Copper is an essential trace element to life and particularly plays a pivotal role in the physiology of aerobic organisms. Copper is a micronutrient that is required for proper metabolic functioning of most prokaryotic and eukaryotic organisms. To sustain an adequate supply of copper, a cell requires molecular mechanisms that control the metal content to avoid copper toxicity. This toxicity comes primarily from the reactivity of copper, which can lead to the generation of free radicals. In bacteria, two independent systems are responsible for maintaining the balance of copper within the cells ( Cop and Cut family proteins ). The Cut protein family is associated with copper homeostasis and involved in uptake, storage, delivery, and efflux of copper. CutC is a member of the Cut family and is suggested to be involved in efflux trafficking of cuprous ion. CutC is able to respond transcriptionally to copper and to participate in the control of copper homeostasis in E. faecalis.

References
  • Lai C.-H., et al., 2000, Genome Res.10:703-713.
  • Li J., et al., 2005, Biochem. Biophys. Res. Commun. 337:179-183.
  • Li,Y. et al., 2010, J Struct Biol. 169 (3):399-405.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Images
    • Human CUTC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"